ID: 1134539935_1134539950

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1134539935 1134539950
Species Human (GRCh38) Human (GRCh38)
Location 16:15056037-15056059 16:15056075-15056097
Sequence CCCGCCGCCCCCGCCCCTCGGGC GTCCTGCCCCGCCCCACCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 139, 4: 988} {0: 1, 1: 0, 2: 7, 3: 47, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!