ID: 1134548356_1134548359

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134548356 1134548359
Species Human (GRCh38) Human (GRCh38)
Location 16:15127356-15127378 16:15127371-15127393
Sequence CCTTTGGTGGACGCCTTTCCCTC TTTCCCTCTGGCTGCAGCACTGG
Strand - +
Off-target summary No data {0: 7, 1: 0, 2: 2, 3: 29, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!