ID: 1134548981_1134548987

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1134548981 1134548987
Species Human (GRCh38) Human (GRCh38)
Location 16:15130558-15130580 16:15130594-15130616
Sequence CCACAGGGCCTGTAACCCGGGCA ATGCCCTGCCCTGCCCTGCCAGG
Strand - +
Off-target summary No data {0: 7, 1: 4, 2: 20, 3: 130, 4: 782}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!