ID: 1134618261_1134618267

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1134618261 1134618267
Species Human (GRCh38) Human (GRCh38)
Location 16:15668519-15668541 16:15668544-15668566
Sequence CCTCCCAAATTGCTGGGATTATA CATGAGCCACCACCTGGCCAGGG
Strand - +
Off-target summary {0: 345, 1: 32646, 2: 349191, 3: 326783, 4: 293515} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!