ID: 1134629946_1134629955

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1134629946 1134629955
Species Human (GRCh38) Human (GRCh38)
Location 16:15749398-15749420 16:15749425-15749447
Sequence CCCTGCTTATCCTAGGCCCCACC CTTCCATGTCACCAAGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152} {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!