ID: 1134649605_1134649619

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1134649605 1134649619
Species Human (GRCh38) Human (GRCh38)
Location 16:15898225-15898247 16:15898275-15898297
Sequence CCCTCCTCTCTTCTTTTCTCTCC CATGTGCCCATCCCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 95, 3: 915, 4: 6187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!