ID: 1134680871_1134680880

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1134680871 1134680880
Species Human (GRCh38) Human (GRCh38)
Location 16:16124599-16124621 16:16124633-16124655
Sequence CCTTCGGCCCTCCCTACCCTGCG TGTTTTGAAAAAGCAGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 228} {0: 1, 1: 0, 2: 1, 3: 33, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!