ID: 1134694598_1134694608

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1134694598 1134694608
Species Human (GRCh38) Human (GRCh38)
Location 16:16214281-16214303 16:16214330-16214352
Sequence CCTCAAAGTGGAACAGGAATGAG CTGGGGGTCTTCAGGGAAGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 26, 4: 237} {0: 2, 1: 0, 2: 5, 3: 55, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!