ID: 1134948203_1134948213

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1134948203 1134948213
Species Human (GRCh38) Human (GRCh38)
Location 16:18340288-18340310 16:18340321-18340343
Sequence CCACAGGGCTGCTGCTGTCCAGG CACCGACGGAGGCCTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 5, 3: 71, 4: 516} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!