ID: 1134963951_1134963961

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1134963951 1134963961
Species Human (GRCh38) Human (GRCh38)
Location 16:18426629-18426651 16:18426659-18426681
Sequence CCTCGCCATCTCTGAGCAGTGGG GGAAGAACAGGGACTGGCCAAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 9, 4: 186} {0: 4, 1: 0, 2: 1, 3: 33, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!