ID: 1134974312_1134974318

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1134974312 1134974318
Species Human (GRCh38) Human (GRCh38)
Location 16:18558690-18558712 16:18558733-18558755
Sequence CCAGACACGAAGTGTTAACCCAG TGAGTCTTCCACGTGTTGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 0, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!