ID: 1135002342_1135002348

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1135002342 1135002348
Species Human (GRCh38) Human (GRCh38)
Location 16:18787310-18787332 16:18787349-18787371
Sequence CCTTCCTCATCCCTCTTTTCCAT AAACTAAGTACCATGGTTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 69, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!