ID: 1135035830_1135035835

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1135035830 1135035835
Species Human (GRCh38) Human (GRCh38)
Location 16:19076027-19076049 16:19076041-19076063
Sequence CCGTCTGCCCTGGCCATACAGCA CATACAGCACAGACAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 284} {0: 1, 1: 0, 2: 6, 3: 22, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!