ID: 1135214408_1135214410

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1135214408 1135214410
Species Human (GRCh38) Human (GRCh38)
Location 16:20552414-20552436 16:20552433-20552455
Sequence CCTGCAGGTTTATAGGCATATGT ATGTTTAAGTATAAGTAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 102} {0: 1, 1: 0, 2: 2, 3: 17, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!