ID: 1135310967_1135310977

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1135310967 1135310977
Species Human (GRCh38) Human (GRCh38)
Location 16:21404303-21404325 16:21404354-21404376
Sequence CCGCTGAGGGTGGAAGCGGCCCC TATCATCTGCTGAGGGTGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 54, 2: 11, 3: 22, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!