ID: 1135526118_1135526134

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1135526118 1135526134
Species Human (GRCh38) Human (GRCh38)
Location 16:23214971-23214993 16:23215015-23215037
Sequence CCTCCCAGCCTGTGCAGGGTCGG GGAATCAGGGTTCCTGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 215} {0: 1, 1: 0, 2: 1, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!