ID: 1135554506_1135554513

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1135554506 1135554513
Species Human (GRCh38) Human (GRCh38)
Location 16:23424819-23424841 16:23424849-23424871
Sequence CCTGGTGAGCTCCTGCTCGGGCC CTCCACGCCGTTGCTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 170} {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!