ID: 1135589570_1135589576

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1135589570 1135589576
Species Human (GRCh38) Human (GRCh38)
Location 16:23695371-23695393 16:23695385-23695407
Sequence CCGTCCCTCAAACTGTCCCCTGG GTCCCCTGGAAAGTGGGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 345} {0: 1, 1: 0, 2: 0, 3: 21, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!