ID: 1135618662_1135618666

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1135618662 1135618666
Species Human (GRCh38) Human (GRCh38)
Location 16:23934049-23934071 16:23934077-23934099
Sequence CCATCCACCCATTTGACTTTCTT GAAACTTTCCCTTTGATCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 380} {0: 1, 1: 0, 2: 2, 3: 26, 4: 575}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!