ID: 1135667878_1135667888

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1135667878 1135667888
Species Human (GRCh38) Human (GRCh38)
Location 16:24351281-24351303 16:24351322-24351344
Sequence CCAGTTTCAGCCAGGCATGGTGG GCACTTTTGGGAGGCCAAAGCGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 71, 3: 270, 4: 1171} {0: 10, 1: 137, 2: 411, 3: 834, 4: 2208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!