|
Left Crispr |
Right Crispr |
| Crispr ID |
1135759044 |
1135759047 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:25121596-25121618
|
16:25121612-25121634
|
| Sequence |
CCATTGCTGGAGAGGCCTCAGGA |
CTCAGGAAACTTAGTCATGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 106, 3: 211, 4: 426} |
{0: 9, 1: 14, 2: 43, 3: 81, 4: 260} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|