ID: 1135868313_1135868317

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1135868313 1135868317
Species Human (GRCh38) Human (GRCh38)
Location 16:26125543-26125565 16:26125569-26125591
Sequence CCAGCGGTTGGGGACCCCTGCTT TAGAATCCTCAAGAAAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 39, 2: 191, 3: 492, 4: 880} {0: 1, 1: 0, 2: 2, 3: 20, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!