ID: 1135992966_1135992981

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1135992966 1135992981
Species Human (GRCh38) Human (GRCh38)
Location 16:27228790-27228812 16:27228832-27228854
Sequence CCATCATGGCACCCCACACCCCC CCTCCCCTCCAGATGCATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 496} {0: 1, 1: 4, 2: 4, 3: 49, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!