ID: 1135996846_1135996849

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1135996846 1135996849
Species Human (GRCh38) Human (GRCh38)
Location 16:27256678-27256700 16:27256702-27256724
Sequence CCATCTCCAGTTACTTAGAACTT GCACCATGTCCTGTCTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 173} {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!