ID: 1136021768_1136021774

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136021768 1136021774
Species Human (GRCh38) Human (GRCh38)
Location 16:27445098-27445120 16:27445112-27445134
Sequence CCCATTTCCCACCATGCCCACCC TGCCCACCCCATATGGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 452} {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!