ID: 1136026207_1136026211

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1136026207 1136026211
Species Human (GRCh38) Human (GRCh38)
Location 16:27470618-27470640 16:27470641-27470663
Sequence CCTGTCTCCTCATCTAATTCAAT GTGGCCTCACCTGGCGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217} {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!