ID: 1136061342_1136061350

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1136061342 1136061350
Species Human (GRCh38) Human (GRCh38)
Location 16:27728725-27728747 16:27728763-27728785
Sequence CCAGCCACATTCAGCCTTTAAAG GAACACTGGGATTCAGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 213} {0: 1, 1: 0, 2: 3, 3: 30, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!