ID: 1136064507_1136064512

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1136064507 1136064512
Species Human (GRCh38) Human (GRCh38)
Location 16:27749704-27749726 16:27749740-27749762
Sequence CCAACACGGAGCTCCCGGGGGAC TCCTGCAGCAAAAGAGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78} {0: 1, 1: 0, 2: 2, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!