ID: 1136101759_1136101764

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1136101759 1136101764
Species Human (GRCh38) Human (GRCh38)
Location 16:28001877-28001899 16:28001908-28001930
Sequence CCTTCAAATTATCATCTACAAGG GCCTATGTATAGGCAAGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174} {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!