ID: 1136146711_1136146718

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1136146711 1136146718
Species Human (GRCh38) Human (GRCh38)
Location 16:28320627-28320649 16:28320646-28320668
Sequence CCGCGCGCGCAAGCCCCCCGGGG GGGGACCGCCCGCCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94} {0: 1, 1: 0, 2: 0, 3: 24, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!