ID: 1136183997_1136184002

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1136183997 1136184002
Species Human (GRCh38) Human (GRCh38)
Location 16:28574385-28574407 16:28574408-28574430
Sequence CCCATCTGAGGCTTTCTTCACTG TTCTGGTGATGTGCCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 68, 3: 139, 4: 312} {0: 1, 1: 0, 2: 3, 3: 12, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!