ID: 1136231624_1136231632

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1136231624 1136231632
Species Human (GRCh38) Human (GRCh38)
Location 16:28888935-28888957 16:28888981-28889003
Sequence CCAGATGTCTGTCTGCAAGGTCA AGTCAGAAGGCTGCCTGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 185} {0: 1, 1: 0, 2: 2, 3: 23, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!