ID: 1136271958_1136271978

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136271958 1136271978
Species Human (GRCh38) Human (GRCh38)
Location 16:29153728-29153750 16:29153772-29153794
Sequence CCCTTCCAGCTGTACTCCCCCTG CGTACTCCCTCTGGGGGCTCTGG
Strand - +
Off-target summary No data {0: 5, 1: 5, 2: 2, 3: 31, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!