ID: 1136271964_1136271979

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1136271964 1136271979
Species Human (GRCh38) Human (GRCh38)
Location 16:29153733-29153755 16:29153773-29153795
Sequence CCAGCTGTACTCCCCCTGGGGGC GTACTCCCTCTGGGGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 13, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!