ID: 1136370084_1136370091

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1136370084 1136370091
Species Human (GRCh38) Human (GRCh38)
Location 16:29830777-29830799 16:29830819-29830841
Sequence CCCTCGCTTGGGCGATAGAGAGG CCTCTTTGGTAGTGGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62} {0: 1, 1: 0, 2: 1, 3: 14, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!