ID: 1136392778_1136392788

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1136392778 1136392788
Species Human (GRCh38) Human (GRCh38)
Location 16:29975744-29975766 16:29975793-29975815
Sequence CCAAAGGATTAAAGCTTTGTGGG CCATATGCTGAGTGTCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 110} {0: 1, 1: 0, 2: 1, 3: 19, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!