ID: 1136399837_1136399841

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1136399837 1136399841
Species Human (GRCh38) Human (GRCh38)
Location 16:30011267-30011289 16:30011288-30011310
Sequence CCCGTGCCCACGTGTGCACGCTC TCACACCCTTGCACACACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137} {0: 1, 1: 0, 2: 2, 3: 61, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!