ID: 1136452166_1136452174

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1136452166 1136452174
Species Human (GRCh38) Human (GRCh38)
Location 16:30359592-30359614 16:30359615-30359637
Sequence CCAAAAGGCTTGCTGAGAAGAGC AAGAACAAGGAGGAGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177} {0: 1, 1: 2, 2: 11, 3: 147, 4: 1238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!