ID: 1136472479_1136472484

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1136472479 1136472484
Species Human (GRCh38) Human (GRCh38)
Location 16:30490509-30490531 16:30490542-30490564
Sequence CCTGGCTCCTCCTGCCTCTTCAC TTTCCCTCTCTGGCCCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 76, 4: 844} {0: 1, 1: 0, 2: 4, 3: 46, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!