ID: 1136477978_1136477988

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1136477978 1136477988
Species Human (GRCh38) Human (GRCh38)
Location 16:30525251-30525273 16:30525294-30525316
Sequence CCTTGCTGCAGACCTCACATTTG GATGCGCTGGTGCTGGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 224} {0: 1, 1: 0, 2: 1, 3: 18, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!