ID: 1136487486_1136487489

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136487486 1136487489
Species Human (GRCh38) Human (GRCh38)
Location 16:30582764-30582786 16:30582778-30582800
Sequence CCGGCTGTCGGAGTGAATGCGCC GAATGCGCCGGTGACTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29} {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!