ID: 1136512712_1136512725

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1136512712 1136512725
Species Human (GRCh38) Human (GRCh38)
Location 16:30748804-30748826 16:30748840-30748862
Sequence CCCCCGCCTCCTTCAGGATGACG CGGAGGATGAGCTGCCCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134} {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!