ID: 1136532145_1136532149

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136532145 1136532149
Species Human (GRCh38) Human (GRCh38)
Location 16:30876852-30876874 16:30876866-30876888
Sequence CCAGCAGGGGCTTTTCTACCATA TCTACCATAAGGAACTTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!