ID: 1136535397_1136535413

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1136535397 1136535413
Species Human (GRCh38) Human (GRCh38)
Location 16:30896464-30896486 16:30896515-30896537
Sequence CCCCACGGACGAGGAGCTGAGCT GGGGGTAGGATGAAATGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 80} {0: 1, 1: 0, 2: 1, 3: 21, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!