ID: 1136566622_1136566630

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1136566622 1136566630
Species Human (GRCh38) Human (GRCh38)
Location 16:31074313-31074335 16:31074363-31074385
Sequence CCGGAAGTGTGTCTGCGTAAAAC CTCCCGAAGCGGAAGTTTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55} {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!