ID: 1136631934_1136631941

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1136631934 1136631941
Species Human (GRCh38) Human (GRCh38)
Location 16:31493914-31493936 16:31493932-31493954
Sequence CCCGCCAGGTTCACCAGCGTCTC GTCTCCTGGAAAATGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 311} {0: 1, 1: 0, 2: 1, 3: 25, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!