ID: 1136641556_1136641561

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1136641556 1136641561
Species Human (GRCh38) Human (GRCh38)
Location 16:31569440-31569462 16:31569456-31569478
Sequence CCGCAGGAGCCTGCTGGAGGGTG GAGGGTGGTGGTGATGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!