ID: 1136724737_1136724756

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1136724737 1136724756
Species Human (GRCh38) Human (GRCh38)
Location 16:32348740-32348762 16:32348778-32348800
Sequence CCCACCTCCTTCAGCTCCTTGCG GTCGGCTTGGGCGCCGGCAGCGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 9, 3: 29, 4: 297} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!