ID: 1136872099_1136872105

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1136872099 1136872105
Species Human (GRCh38) Human (GRCh38)
Location 16:33816724-33816746 16:33816738-33816760
Sequence CCTCAGAACCACCAGGGGGCGCT GGGGGCGCTGAGGACACCAGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 12, 3: 21, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!