ID: 1136910774_1136910781

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1136910774 1136910781
Species Human (GRCh38) Human (GRCh38)
Location 16:34142555-34142577 16:34142568-34142590
Sequence CCTCTCCCCCTCTCCAGCCCAGC CCAGCCCAGCCAGGCTGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 18, 3: 222, 4: 1555} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!